Coding

Part:BBa_K1111014:Experience

Designed by: Sandra Elisabeth Chaudron, Caroline Desmurget and Mareike Apelt   Group: iGEM13_EPF_Lausanne   (2013-09-19)


This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1111014

Sequencing

We sequenced this part once the Gibson assembly made. To do so, we used primers for iGEM sites VF2 and VR, in order to sequence all that was inserted in the backbone pSB1C3. The sequencing results were aligned to the theoretical coding sequences using ClustalW2 program [http://www.ebi.ac.uk/Tools/msa/clustalw2/]. In the following pdf, the starts mean 100% matching sequences.
VF2 sequencing results of INP_Streptavidin BBa_K283010:
File:Team-EPF-Lausanne ClustalW2 VF2 ISI.pdf
VR sequencing results of INP_Streptavidin BBa_K283010:
File:Team-EPF-Lausanne ClustalW2 VR ISI.pdf
Note: you can notice that there is no overlap between the two sequencing results but thanks to another forward primer (5'- AATAATATGGCCGACCATTG -3') we designed, we were able to confirm the sequences.


User Reviews

UNIQ415255a112708bf0-partinfo-00000000-QINU UNIQ415255a112708bf0-partinfo-00000001-QINU